It remains to be seen if testing will reveal G-M377 haplotypes in other populations this is some indication that G-M377 occurs at low levels in the Near East. [25], In the Middle East, haplogroup G accounts for about 3% of the population in almost all areas. The highest frequency values for P303 are detected in populations from Caucasus region, being especially high among South Caucasian Abkhazians (24%) and among Northwest (NW) Caucasian Adyghe and Cherkessians39.7% and 36.5%, respectively. (2004) suggested the mutation took place only 9,500 years ago. P287 was identified at the University of Arizona and became widely known in late 2007. Its identification caused considerable renaming of G categories. Moreover, these general frequencies mostly consist of two notable lineages. However, interpretations based on coarse haplogroup resolution frequency clines are unsophisticated and do not recognize underlying patterns of genetic diversification. [26][27] Among the Druze mostly residents of Israel 10% were found to be haplogroup G.[28], Around 10% of Jewish males are Haplogroup G.[citation needed], In Africa, haplogroup G is rarely found in sub-Saharan Africa or south of the horn of Africa among native populations. In Egypt, studies have provided information that pegs the G percentage there to be between 2% and 9%. Hg G is most common in the Caucasus with a maximum frequency exceeding 70% in North Ossetians,2, 3 decreasing to 13% in Iran4 and then rapidly dissipating further eastward. Princeton: Princeton University Press, 1994. Men with the haplogroup G marker moved into Europe in Neolithic times. The Y-chromosomal haplogroup G (hg G) is currently defined as one of the 20 standard haplogroups comprising the global Y-chromosome phylogeny.1 The phylogeographic demarcation zone of hg G is largely restricted to populations of the Caucasus and the Near/Middle East and southern Europe. A more compact cluster of Near/Middle Eastern samples is also resolved in the network. "[3], Previously the National Geographic Society placed its origins in the Middle East 30,000 years ago and presumes that people carrying the haplogroup took part in the spread of the Neolithic. G-M201 is most commonly found among various ethnic groups of the Caucasus, but is also widely distributed at low frequencies among ethnic groups throughout Europe, South Asia, Central Asia, and North Africa. Proc Natl Acad Sci USA 2011; 108: 97889791. They arewith accompanying Y-chromosome locationsU5 (rs2178500), L149 (8486380) and L31 (also called S149) (rs35617575..12538148). In the Russian North Caucasus the Kabardinian and Ossetian populations are also notable for high rates of G-M201. (2000) suggested 17,000 years ago. The double 19 value situation is not seen in the G2a1 and G2a3 subclades. You are using a browser version with limited support for CSS. Included within G-L91 are some men with double values for STR marker DYS19, but there are also G2a2 men with this finding who are not L91+. Semino O, Magri C, Benuzzi G, Lin AA, Al-Zahery N, et al. M286 was first identified at Stanford University at chromosome position 21151187, and is a mutation from G to A. [citation needed] No labs have yet assigned them shorthand names. It is a branch of haplogroup G (Y-DNA) (M201). Human Y chromosome DNA grouping common in western Eurasia, This article is about the human Y-DNA haplogroup. The National Geographic Society places haplogroup G origins in the Middle East 30,000 years ago and presumes that people carrying the haplogroup took part in the spread of the Neolithic Two scholarly papers have also suggested an origin in the Middle East, while differing on the date. Haplogroup G is a branch on the maternal tree of human kind. G2a2b1 is more common in southern Europe than northern Europe. Haplogroup L2b1a is a branch on the maternal tree of human kind. Flores C, Maca-Meyer N, Gonzalez AM et al. Although hg G1 frequency distribution, overall, extends further eastward as far as Central Asian Kazakhs (present even among Altaian Kazakhs38 with identical STR haplotypes compared with the main Kazakh population), it is virtually absent in Europe. Iceman tzi, known to have been a haplogr. There are seeming pockets of unusual concentrations within Europe. Although compared with G1-M285, the phylogenetic level of P303 (Figure 1) is shallower but its geographic spread zone covers the whole hg G distribution area (Figure 2b). AAL thanks the Sorenson Molecular Genealogy Foundation. P257 was first reported in 2008. Concerning the presence of hg G in the Caucasus, one of its distinguishing features is lower haplogroup diversity in numerous populations (Supplementary Table S1) compared with Anatolia and Armenia, implying that hg G is intrusive in the Caucasus rather than autochthonous. Extended Y chromosome haplotypes resolve multiple and unique lineages of the Jewish priesthood. Although the phylogenetic resolution within hg G has progressed,1, 17 a comprehensive survey of the geographic distribution patterns of significant hg G sub-clades has not been conducted. Haplogroup G, together with J2 clades, has been associated with the spread of agriculture, especially in the European context. The phylogeny obtained for haplogroup Q-M378 comprising 5.2% of the Ashkenazi paternal variation 24, shows a similar pattern to that observed for haplogroup G-M377 (Supplemental Figure S5). G-M377, now also known as G2b1, has previously been designated G2b and G2c. Am J Hum Genet 2001; 68: 10191029. Haplogroup G2a (G-P15) has been identified in Neolithic human remains in Europe dating between 5000 and 3000 BC. However, its sub-clades have more localized distribution with the U1-defined branch largely restricted to Near/Middle Eastern and the Caucasus, whereas L497 lineages essentially occur in Europe where they likely originated. The phylogenetic relationships of the various sub-haplogroups investigated are shown in Figure 1. Distribution. [12] The fourth site also from the same period is the tztal of the Italian Alps where the mummified remains of tzi the Iceman were discovered. The Network 4.6.0.0 (Fluxus-Engineering) program was used (median-joining algorithm and the post-processing option). First, the G2a1-P16 lineage is effectively Caucasus specific and accounts for about one-third of the Caucasian male gene pool (Figure 2f). Furthermore, the U1-specific sub-clade M527 is most pronounced among Ukrainians and Anatolian Greeks. It is a branch of Haplogroup F (M89), and is theorized to have originated, according to the latest thinking, in the Near East or Southern Asia, likely in the region that is now northern India, Pakistan, and Afghanistan. Semino et al. Several G-PF3359 subclades, based on shared STR markers, probably exist. Y chromosome genetic variation in the Italian peninsula is clinal and supports an admixture model for the Mesolithic-Neolithic encounter. RV and DMB thank the European Commission, Directorate-General for Research for FP7 Ecogene grant 205419. Because SNPs provide the most reliable method of categorization, each is allowed to represent an official G category. The genome-wide structure of the Jewish people. Use the Previous and Next buttons to navigate the slides or the slide controller buttons at the end to navigate through each slide. Haplogroup LT (L298/P326) is also known as Haplogroup K1. But a high percentage of U1 men belong to its two subclades, G-L13/S13 and Z1266 (G2a3b1a1b). [8][9], Furthermore, the majority of all the male skeletons from the European Neolithic period have so far yielded Y-DNA belonging to this haplogroup. Herein . These are found at: rs9786910, rs9786537, rs2713254, rs35567891 and rs34621155 on the Y chromosome. These Neolithic European were descendants of Neolithic farmers from Anatolia, among some of the earliest peoples in the world to practice agriculture. Furthermore, markers Page94, U5, U8 and L30 were typed in contextually appropriate samples to establish the position of the five new markers within the phylogeny. Haplogroup G was the first branch of Haplogroup F outside of Africa. Y-chromosomal evidence of the cultural diffusion of agriculture in Southeast Europe. The new phylogenetic and phylogeographic information provides additional insights into the demographic history and migratory events in Eurasia involving hg G. The present study comprises data from 98 populations totaling 17577 individuals, of which 1472 were members of hg G. The haplogroup frequency data are presented in Supplementary Table S1. The origin of haplogroup G is controversial. Using Y-STR data, the Td expansion time for all combined P15-affiliated chromosomes was estimated to be 150822217 years ago. The Madjar and Argyn tribes (or clans) of Kazakhstan were found to possess the highest levels of G-M201 among any modern ethnic group. In the G2a3b-P303 network (Figure 4), there are several region-specific clusters, indicating a considerable history for this SNP. Am J Hum Genet 2003; 72: 313332. Lacan M, Keyser C, Ricaut FX et al. Mol Biol Evol 2011; 28: 29052920. https://doi.org/10.1038/ejhg.2012.86, DOI: https://doi.org/10.1038/ejhg.2012.86. A clade of closely related Ashkenazi Jews represent virtually all G2b persons, with just three other G2b haplotypes having been reported so far: one Turk from Kars in northeast Turkey near Armenia, one Pashtun, and one Burusho in Pakistan. Evaluation of Y-chromosomal STRs: a multicenter study. SR thanks the Estonian Science Foundation for grant 7445 and M Metspalu for grant 8973. While it is found in percentages higher than 10% among the Bakhtiari, Talysh people, Gilaki, Mazandarani and Iranian Azeris, it is closer to 5% among the Iranian Arabs and in some large cities. The SNP L497 encompasses these men, but most G-L497 men belong to its subclade G-Z725, also known as G-DYS388=13. Capelli C, Brisighelli F, Scarnicci F et al. All G-M377 men tested so far also have a rare null value for the DYS425 marker, (a missing "T" allele of the DYS371 palindromic STR), the result of a RecLOH event, a finding not yet seen among most other G haplotypes. G-M406* (G2a2b1*; previously G2a3a*) and its subclades seem most commonly found in Turkey and the coastal areas of the eastern Mediterranean where it can constitute up to 5% of all makes and 50% of haplogroup G samples. Am J Hum Genet 2000; 67: 15261543. Ann Hum Genet 2004; 68: 588599. The network was obtained using the biallelic markers P303, M426, L497, U1, M527 and 19 STR loci (DYS19, DYS388, DYS389I, DYS389b, DYS390, DYS391, DYS392, DYS393, DYS439, DYS461 (TAGA counts), DYS385a,b, DYS437, DYS438, DYS448, DYS456, DYS458, DYS635, YGATAH4). We attempted to localize the potential geographic origin of . PLoS One 2009; 4: e5792. [44] The "U" SNPs were identified in 2006 but not published until 2009.[45]. Martinez L, Underhill PA, Zhivotovsky LA et al. G1 is possibly believed to have originated in Iran. This video explains the migration route of Y-chromosome haplogroup G and the countries where it can be found today. G-M201 has also been found in Neolithic Anatolian sites such as Boncuklu dating back to 8300-7600 BCE, and Barcin dating back to 6419-6238 BCE. Spatial autocorrelation analysis was carried out to assess the presence/absence of clines regarding informative G sub-haplogroups. Digora, North Ossetia has the highest known concentration of G in a single city, as 74% of the tested men were G.[14] Haplogroup G is found as far east as northern China in small percentages where G can reach more substantial percentages in minority groups such as the Uyghurs. See: Poznik. While neither knowledge of paleo-climate, archeology or genetic evidence from a single locus using modern populations provides an unimpeachable microcosm of pre-historical expansions, considering them together cautiously provides a contextual framework for discussion. Pericic M, Lauc LB, Klaric IM, Janicijevic B, Rudan P : Review of croatian genetic heritage as revealed by mitochondrial DNA and Y chromosomal lineages. the best experience, we recommend you use a more up to date browser (or turn off compatibility mode in The formula for the coalescence calculations is as follows: Age=25/1000 ASD0/0.00069. A separate study on the Argyns found that 71% of males belong to G1. The first principal component separates the populations of the Caucasus from those of Europe, with the Near/Middle Eastern populations being intermediate (Figure 3a). Paleolithic Y-haplogroup heritage predominates in a Cretan highland plateau. [43] L240 was identified in 2009. (a)(f) Spatial frequency maps of haplogroup G (hg G) and its sub-clades with frequencies over 10%. King RJ, Ozcan SS, Carter T et al. Haplogroup G1 is a primary subclade of haplogroup G . It encompasses a small group of Hispanic men who also so far all have the odd value of 13,21 at the YCA marker. The forward primer is GTATTGAACTTACAATTCACGTCCC, and the reverse is CTCTCCAAATCGGGTTTCCT. Chromosome Y microsatellites: population genetic and evolutionary aspects. They are found only in tiny numbers elsewhere. G-P16 is also occasionally present in Northeast Caucasus at lower frequencies (Supplementary Table S1), consistent with a previous report.3 Outside the Caucasus, hg G-P16 occurs at 1% frequency only in Anatolia, Armenia, Russia and Spain, while being essentially absent elsewhere. Among Jews in Israel drawn from many areas of the world, G-M377 constituted 3.7% in one study. Considering these issues, we acknowledge that the variance of the age estimates may be underestimated. The M201 SNP mutation that characterizes haplogroup G was identified at Stanford University and was first reported in 2001. ), Ancient G-M201s with sequencing[self-published source?] The Turkish G-M377 is somewhat closer, but not identical. Barac L, Pericic M, Klaric IM et al. Genomics 1999; 57: 433437. Men with the haplogroup G marker moved into Europe in Neolithic times. You belong to a subgroup of haplogroup G (G-M201), The Caucasus Mountaineers, and your oldest. Russ J Genet 2004; 40: 326331. The P303 SNP defines the most frequent and widespread G sub-haplogroup. Eur J Hum Genet 2010; 18: 348353. Similarly, G-P16 and G-M377 networks were created using 104 P16-derived 19-locus haplotypes and 61G-M377-derived 9-locus haplotypes, with both groups representing European, Near/Middle Eastern and central/west Asian populations. To accommodate for variability in sample sizes and hg G content, haplogroup diversity was calculated using the method of Nei37 only in the 52 instances when total population sample size exceeded 50 individuals and 5hg G chromosomes were observed. The highest reported concentration of G1 and its subclades in a single country is in Iran, with next most frequent concentrations in neighboring countries to the west. Hum Hered 2006; 61: 132143. [4], Two scholarly papers have also suggested an origin in the Middle East, while differing on the date. PLoS Biol 2010; 8: e1000536. It is provided at the request of readers. Origin. The next largest subclade of G-P303 is characterized by the presence of the U1 mutation. Origin and Migrations of Haplogroup G-M201 The first man to carry haplogroup G-M201 likely lived in southwestern Asia or the Caucasus between 46,000 and 54,000 years ago. It is a child of haplogroup M12'G. It was likely born in the East Asia around 32,000 years ago. Spatial frequency maps for hg G sub-clades that attained 10% frequency in at least one population were obtained by applying the haplogroup frequencies from Supplementary Table S1. Genetic evidence concerning the origins of South and North Ossetians. In Wales, a distinctive G2a3b1 type (DYS388=13 and DYS594=11) dominates there and pushes the G percentage of the population higher than in England. Hammer MF, Behar DM, Karafet TM et al. MH and MHS are thankful to the National Institute for Genetic Engineering and Biotechnology, Tehran, Iran, and the National Research Institute for Science policy, Tehran, Iran, for providing the samples. Although the low frequency of hg G1-M285 makes it impractical to justify displaying a spatial frequency map, it is found (Supplementary Table S1) in the Near/Middle East including Anatolia, the Arabian Peninsula and Persian Gulf region, as well as Iran and the South Caucasus (mostly Armenians). The genetic heritage of the earliest settlers persists both in Indian tribal and caste populations. Its chromosome location listed as 21653414. Thus, G2a3a-M406, along with other lineages, such as J2a3b1-M92 and J2a4h2-DYS445=616, may track the expansion of the Neolithic from Central/Mediterranean Anatolia to Greece/Italy and Iran. Google Scholar. The most recent study (2010) estimates the common ancestor of all men in haplogroup G lived in Asia about 17,000 years ago, and the ancestor of the G2 subgroup lived about 15,000 years ago. The G2 clade consists of one widespread but relatively infrequent collection of P287*, M377, M286 and M287 chromosomes versus a more abundant assemblage consisting of G2a-related P15*, P16 and M485-related lineages. Here we present the haplogroup frequency distribution and STR variation of 16 informative G sub-clades by evaluating 1472 haplogroup G chromosomes belonging to 98 populations ranging from Europe to Pakistan. [41] These classifications are based on shared SNP mutations. In addition, K-Y28299, which appears to be a primary branch of K-M2313, has been found in three living individuals from India. Regueiro M, Cadenas AM, Gayden T, Underhill PA, Herrera RJ : Iran: tricontinental nexus for Y-chromosome driven migration. No clinal patterns were detected suggesting that the distributions are rather indicative of isolation by distance and demographic complexities. This skeleton could not be dated by radiocarbon dating, but other skeletons there were dated to between 5,100 and 6,100 years old. [39], Haplogroup G-M377 has been found at a frequency of 60% out of a sample of five Pashtuns in the Wardak region of Afghanistan. If a sample meets the criteria indicated for these three markers, it is likely the sample is G2a2b1. The hg G individuals in Supplementary Table S1 were either first genotyped for this study or updated to present phylogenetic resolution from earlier studies.2, 4, 10, 11, 13, 16, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27 All hg G (M201-derived) samples were genotyped in a hierarchical manner for the following binary markers: M285, P20, P287, P15, L91 P16, M286, P303, U1, L497, M406, Page19, M287 and M377. Ann Hum Genet 2005; 69: 443454. Am J Hum Genet 2004; 74: 694704. The Levant versus the Horn of Africa: evidence for bidirectional corridors of human migrations. Lacan M, Keyser C, Ricaut FX et al. G-P303*, also known as G2a2b2a* (previously G2a3b1*), and its subclades are now concentrated in southern Russia and the Caucasus, as well as, at lower levels, other parts of Europe and South West Asia, especially an area including Turkey, Iran and the Middle East where G2a2b2a may have originated. These patterns have been related to different migratory events and demographic processes.2, 10, 11, 14, 15, 16. Its members include "tzi",[citation needed] the so-called Iceman, who died at least 5,000 years BP in the European Alps. New York: Columbia University Press, 1987. Dulik MC, Osipova LP, Schurr TG : Y-chromosome variation in Altaian Kazakhs reveals a common paternal gene pool for Kazakhs and the influence of Mongolian expansions. Haplogroup P (P295) is also klnown as K2b2. Name: G-L14 Age: 7800 ybp 1700 CI 95% Expansion: 5200 ybp 1900 CI 95% Parent: G-L1 Note: This information does not imply an endorcement of YFull or their methods. The Iceman belongs to haplogroup G2a2b [13] (earlier called G2a4). His male-line descendants appear to remained rooted in the region for tens of thousands of years while the Ice Age was in full swing. We estimate that the geographic origin of hg G plausibly locates somewhere nearby eastern Anatolia, Armenia or western Iran. Spallanzani, Universit di Pavia, Pavia, Italy, Viola Grugni,Vincenza Battaglia,Carmela Nici,Francesca Crobu,Sena Karachanak,Baharak Hooshiar Kashani&Ornella Semino, Department of Medical Genetics, Medical University of Sofia, Sofia, Bulgaria, National Institute of Genetic Engineering and Biotechnology (NIGEB), Tehran, Iran, Istituto di Genetica Molecolare Centro Nazionale delle Ricerche, Pavia, Italy, Centro Interdipartimentale Studi di Genere, Universit di Pavia, Pavia, Italy, Unit Mixte de Recherche 6578, Centre National de la Recherche Scientifique, and Etablissement Franais du Sang, Biocultural Anthropology, Medical Faculty, Universit de la Mditerrane, Marseille, France, Estonian Academy of Sciences, Tallinn, Estonia, Department of Biological Anthropology, University of Cambridge, Cambridge, UK, Department of Genetics, Stanford University School of Medicine, Stanford, CA, USA, You can also search for this author in [29][30][31] 3% of North African Berbers were found to be haplogroup G.[32] 2% of Arab Moroccans and 0.8% of Berber Moroccans were likewise found to be G.[33]. White PS, Tatum OL, Deaven LL, Longmire JL : New, male-specific microsatellite markers from the human Y chromosome. The International Society of Genetic Genealogy (ISOGG) maintains the most up-to-date consensus version of haplogroup categories. Because M201 was identified first, it is the standard SNP test used when testing for G persons. OS thanks the Italian Ministry of the University: Progetti Ricerca Interesse Nazionale 2009 and FIRB-Futuro in Ricerca 2008 and Fondazione Alma Mater Ticinensins.